| Worm gene name: | unc-26 |
| Worm sequence name: | F11E6.1 |
| Related human gene: | GBA2 |
| Associated human disease: | Gaucher disease type III |
| People involved in this project: |
|
| Left primer sequence: | cctggatgggctgacactat |
| Right primer sequence: | ggcccaatgcatagaacatt |
| Size of PCR product: | 394 |
| Brief description: | Acid beta-glucocerebrosidase, also known as beta-glucosidase (GBA; EC 3.2.1.45), is a lysosomal enzyme that catalyzes the breakdown of the glycolipid glucosylceramide to ceramide and glucose. The genes for production of the enzyme glucocerebrosidase are passed from parent to child. In patients with Gaucher disease, two copies of the glucocerebrosidase gene that the individual inherited from his or her parents are both defective; thus, the glucocerebrosidase is unable to function normally. Primers have been designed for RNAi silencing of unc-26, but experiments haven't been done. |
| Report any problems that might have appeared and any solutions: | |
