| Worm gene name: | brc-1 |
| Worm sequence name: | C36A4.8 |
| Related human gene: | BRCA1 |
| Associated human disease: | Breast Cancer Suppressor Protein |
| People involved in this project: |
|
| Left primer sequence: | caaaccgacacaaaatcacg |
| Right primer sequence: | tttcctgaaaaacggcattc |
| Size of PCR product: | 966 |
| Brief description: | brc-1 in C. elegan is closely related to BRCA1 in humans. BRCA1 causes an early onset breast and ovarian cancer. BRC-1 damage chromatin; brc-1(RNAi) animals have excess chromosomal nondisjunction, abnormally high levels of CEP-1-dependent germ cell apoptosis |
| Report any problems that might have appeared and any solutions: | |
