Home | Projects | Login or register:
Username:   Password:

Worm gene name:  brc-1
Worm sequence name:  C36A4.8
Related human gene:  BRCA1
Associated human disease:  Breast Cancer Suppressor Protein
People involved in this project: 
Left primer sequence:  caaaccgacacaaaatcacg
Right primer sequence:  tttcctgaaaaacggcattc
Size of PCR product:  966
Brief description:  brc-1 in C. elegan is closely related to BRCA1 in humans. BRCA1 causes an early onset breast and ovarian cancer. BRC-1 damage chromatin; brc-1(RNAi) animals have excess chromosomal nondisjunction, abnormally high levels of CEP-1-dependent germ cell apoptosis
Report any problems that might have appeared and any solutions: 
View(0) or add comments