Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ape-1
Worm sequence name:  F46F3.4
Related human gene:  p53
Associated human disease:  tumor suppressor
People involved in this project: 
Left primer sequence:  caacagcaaccatcacc
Right primer sequence:  taaagcagcatcgagcaaga
Size of PCR product:  864
Brief description:  ape-1 refers to an apoptosis enhancer gene first discovered by Kuwabara. It encodes a 769 aa protein that induces apoptosis in the germline and inhibits a DNA damage checkpoint. Ape-1 binds CEP-1 in vitro.
Report any problems that might have appeared and any solutions: 
View(0) or add comments