| Worm gene name: | ape-1 |
| Worm sequence name: | F46F3.4 |
| Related human gene: | p53 |
| Associated human disease: | tumor suppressor |
| People involved in this project: |
|
| Left primer sequence: | caacagcaaccatcacc |
| Right primer sequence: | taaagcagcatcgagcaaga |
| Size of PCR product: | 864 |
| Brief description: | ape-1 refers to an apoptosis enhancer gene first discovered by Kuwabara. It encodes a 769 aa protein that induces apoptosis in the germline and inhibits a DNA damage checkpoint. Ape-1 binds CEP-1 in vitro. |
| Report any problems that might have appeared and any solutions: | |
