| Worm gene name: | XPA-1 |
| Worm sequence name: | K07G5.2 |
| Related human gene: | XPA |
| Associated human disease: | XERODERMA PIGMENTOSUM |
| People involved in this project: |
|
| Left primer sequence: | tgtgaaaagtgcgacaaagg |
| Right primer sequence: | tccacgtgagtttctttccc |
| Size of PCR product: | 540 |
| Brief description: | Human gene XPA is one of the genes that when muatated cauases the disease Xeroderma Pigmentosum. This condition is charactierized by extreme sensitivity to UV light (blistering skin is common) and susceptibility to various types of cancer. The human gene is involved in excision DNA repair of damaged DNA. It is a zinc finger containing DNA binding protein. In C. elegans loss of the XPA-1 genes leads to increased sensitivity to UV light. The C. elegans protein has 241 amino acids the gene has 5 exons. The human protein is 273 amino acids. |
| Report any problems that might have appeared and any solutions: | No problems reported. |
