Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ctb-1
Worm sequence name:  MTCE.21
Related human gene:  mitochondrial cytochrome b
Associated human disease:  Parkinson's
People involved in this project: 
Left primer sequence:  cgcccgataggttaatagca
Right primer sequence:  tggccctcaaattggaataa
Size of PCR product:  308
Brief description:  There is some evidence to indicate that a defect in the gene encoding the mitochondrial electron transport protein, cytoshrome Ib, is involved in Parkinson's disease in humans. This may lead to a devastating loss of ATP synthesis in the tissues of the brain. Why this would affect specific regions of the brain, specifically the substantia nigra is not known.
Report any problems that might have appeared and any solutions: 
View(0) or add comments