Home | Projects | Login or register:
Username:   Password:

Worm gene name:  cft-1
Worm sequence name:  C18C4.2
Related human gene:  cft-1
Associated human disease:  Cystic Fibrosis
People involved in this project: 
Left primer sequence:  ttcaacattcatccgaacca
Right primer sequence:  catgggtcaatgttgctacg
Size of PCR product:  534
Brief description:  Related to the gene that produces a transmembrane protein responsible for moving chloride across the cell membrane.
Report any problems that might have appeared and any solutions: 
View(0) or add comments