| Worm gene name: | cft-1 |
| Worm sequence name: | C18C4.2 |
| Related human gene: | cft-1 |
| Associated human disease: | Cystic Fibrosis |
| People involved in this project: |
|
| Left primer sequence: | ttcaacattcatccgaacca |
| Right primer sequence: | catgggtcaatgttgctacg |
| Size of PCR product: | 534 |
| Brief description: | Related to the gene that produces a transmembrane protein responsible for moving chloride across the cell membrane. |
| Report any problems that might have appeared and any solutions: | |
