| Worm gene name: | nob-1 |
| Worm sequence name: | Y75B8A.2 |
| Related human gene: | NOB1 |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | tcggtgatgcaacaaatgat |
| Right primer sequence: | gccagcggattttgatagaa |
| Size of PCR product: | 352 |
| Brief description: | nob-1 encodes a HOX protein, in the posterior paralog group in C. elegans. In yeast, nob-1 is required for proteasome function and RNA metabolism. |
| Report any problems that might have appeared and any solutions: | |
