Home | Projects | Login or register:
Username:   Password:

Worm gene name:  nob-1
Worm sequence name:  Y75B8A.2
Related human gene:  NOB1
Associated human disease: 
People involved in this project: 
Left primer sequence:  tcggtgatgcaacaaatgat
Right primer sequence:  gccagcggattttgatagaa
Size of PCR product:  352
Brief description:  nob-1 encodes a HOX protein, in the posterior paralog group in C. elegans. In yeast, nob-1 is required for proteasome function and RNA metabolism.
Report any problems that might have appeared and any solutions: 
View(0) or add comments