| Worm gene name: | B0432.4 |
| Worm sequence name: | B0432.4 |
| Related human gene: | UPC2 |
| Associated human disease: | Obesity |
| People involved in this project: |
|
| Left primer sequence: | attccaggagtcgtcaatgc |
| Right primer sequence: | aagtaggcggcattcatttg |
| Size of PCR product: | 562 |
| Brief description: | The uncoupling protein plays a role in producing heat and burning calories by creating trails that allows dissipation of the proton electrochemical gradient across the inner mitochondrial membrane in brown adipose tissue, without coupling to any other energy-consuming process. This pathway has been implicated in the regulation of body temperature, body composition, and glucose metabolism. In C. elegan, the UPC2 gene serses as a mitochondrial substrate carier and is involved in brown fat upcoupling. |
| Report any problems that might have appeared and any solutions: | |
