| Worm gene name: | ubc-20 |
| Worm sequence name: | F40G9.3 |
| Related human gene: | huntingtin |
| Associated human disease: | Huntington's disease |
| People involved in this project: |
|
| Left primer sequence: | aataaagtgaccgccgtttg |
| Right primer sequence: | ttttccaacatgagcatcca |
| Size of PCR product: | 709 |
| Brief description: | Huntington's disease is an autosomal dominant disorder that typically appears beginning in mid-life. An ortholog in C. elegans to one of the genes involved in this disorder was found using BLAST.
Further, this gene is apparently expressed in muscle tissue (body wall, pharynx, intestine, etc.) of adult C. elegans. E-RNAi was then used to determine suitable primers for the worm gene. The amplicon (709 bp)sequence, according to E-RNAi, is as follows: tttttcgcggaatttactggttttttcttgtttttcaaccaggaaatcgttcaaattcat cactttttgtcccagaagccgagaaaaatcagtttttcagctcatatcgaaatttgtttt tcaaaaagaaattataaaaaagtttagcagacccaaaactcaacaaatttggcgaagttg tttttagtctaaaaactcgaatttccccgaaaattcgttgtttccagtgagtgtaaaaac tcgagaaatctcaaaaaaaaaattggttttcattcgaattttctcaatttccacgcttga aaactttaggtagcctagaaaatagacaaacatagacaacataaactgaataatagccta atatgctcttaatatactaaatttccaccatttttcagGCCACCGCCGAGTACTGGACGA CAAAATTCGCAAAGGGAGCCGTGAAAAACGCCGGATACCAGGCTCTCGTCGACAAGCTCA AGGATATGGGAGTCCGTGAGGAAGAGGCTGTCAGCGTGCTCAGCTGCAACAATTGGGACA TCAATCGCTCGACGGTCTACATTTTCTCTTAAattcttttttattcgatttttttgaatt ttttctgtgagcctcttgtcttgaagtttgtgtcctaaaaatcccttatttcttccattt ttttccgagaaattttcgtccccaaccccccgcaccactggtatttctt It would be interesting to do an RNAi knockdown of this gene in C. elegans. If phenotype is affected, an extension could be to do this at different life-stages. |
| Report any problems that might have appeared and any solutions: | |
