Home | Projects | Login or register:
Username:   Password:

Worm gene name:  egl-15
Worm sequence name:  F58A3.2
Related human gene:  FGRF3
Associated human disease:  Achondroplasia
People involved in this project: 
Left primer sequence:  atggcgaatgccactttaac
Right primer sequence:  ggatccgaatcaacctcgta
Size of PCR product:  410
Brief description:  Achondroplasia is an autosomal dominant disorder characterized by abnormal bone growth that results in short stature with disproportionately short arms and legs, and a large head Intelligence and life span are usually normal.
Achondroplasia is associated with a defect in the FGFR3 gene. 99% off affected individuals exhibit mutations in the FGFR3 gene. A significant number of affected individuals result from spontaneous mutations of this gene. Using the NCBI web page I located a homologous gene in C. elegans(egl-15) and developed primers using the E-RNAi web page. I have not had time to go any further at this point.
Report any problems that might have appeared and any solutions: 
View(0) or add comments