| Worm gene name: | egl-15 |
| Worm sequence name: | F58A3.2 |
| Related human gene: | FGRF3 |
| Associated human disease: | Achondroplasia |
| People involved in this project: |
|
| Left primer sequence: | atggcgaatgccactttaac |
| Right primer sequence: | ggatccgaatcaacctcgta |
| Size of PCR product: | 410 |
| Brief description: | Achondroplasia is an autosomal dominant disorder characterized by abnormal bone growth that results in short stature with disproportionately short arms and legs, and a large head Intelligence and life span are usually normal.
Achondroplasia is associated with a defect in the FGFR3 gene. 99% off affected individuals exhibit mutations in the FGFR3 gene. A significant number of affected individuals result from spontaneous mutations of this gene. Using the NCBI web page I located a homologous gene in C. elegans(egl-15) and developed primers using the E-RNAi web page. I have not had time to go any further at this point. |
| Report any problems that might have appeared and any solutions: | |
