| Worm gene name: | hex-1 |
| Worm sequence name: | T14F9.3 |
| Related human gene: | HEXA |
| Associated human disease: | Tay-Sachs |
| People involved in this project: |
|
| Left primer sequence: | ggagaggcagaaagggattc |
| Right primer sequence: | gcgtttggatcaggaatgtt |
| Size of PCR product: | 376 |
| Brief description: | Tay-Sachs disease is a rare inherited disorder that causes progressive destruction of nerve cells in the brain and spinal cord. More than 100 mutations that cause Tay-Sachs have been identified in the HEXA gene. These mutations interfere with the activity of the beta-hexosaminidase A enzyme, preventing the normal breakdown of GM2 ganglioside in the brain and spinal cord. As a result, this substance builds up to toxic levels in nerve cells. Progressive damage caused by the buildup of GM2 ganglioside leads to the destruction of these cells, which causes the signs and symptoms of Tay-Sachs disease. Infants who are affected with Tay-Sachs appear normal until the age of 3-6 months. Onset of the disease includes loss of motor skills such as turning over, sitting, and crawling. Seizures, vision and hearing loss, mental retardation, and paralysis occur as the disease progresses. Children with this severe infantile form of Tay-Sachs disease usually survive only into early childhood. |
| Report any problems that might have appeared and any solutions: | |
We used these primers to try to amplify the 376 bp fragment using PCR, but unfortuately we did not get any product. We ran the PCR at both 60 and 55 degrees for the annealing temperature. This may due to the thermocycler at our particular workshop, because the instructors reported getting a product when they tried at Cold Spring Harbor. In support of this, several other groups failed to get products when using other primers from previous workshop projects.