| Worm gene name: | ncr1 |
| Worm sequence name: | F02E8.6 |
| Related human gene: | npc1 |
| Associated human disease: | Niemann Pick |
| People involved in this project: |
|
| Left primer sequence: | cgtcttcgcatacagcaaaa |
| Right primer sequence: | gagcaggcgtatcctttgag |
| Size of PCR product: | 355 |
| Brief description: | Niemann-Pick type C (NPC) disease is an autosomal recessive lipid storage disorder characterized by progressive neurodegeneration. Approximately 95% of cases are caused by mutations in the NPC1 gene, referred to as type C1.Two primers were designed for RNAi silencing of the C. elegan ncr1 gene. |
| Report any problems that might have appeared and any solutions: | |
