Home | Projects | Login or register:
Username:   Password:

Worm gene name:  ncr1
Worm sequence name:  F02E8.6
Related human gene:  npc1
Associated human disease:  Niemann Pick
People involved in this project: 
Left primer sequence:  cgtcttcgcatacagcaaaa
Right primer sequence:  gagcaggcgtatcctttgag
Size of PCR product:  355
Brief description:  Niemann-Pick type C (NPC) disease is an autosomal recessive lipid storage disorder characterized by progressive neurodegeneration. Approximately 95% of cases are caused by mutations in the NPC1 gene, referred to as type C1.Two primers were designed for RNAi silencing of the C. elegan ncr1 gene.
Report any problems that might have appeared and any solutions: 
View(0) or add comments