| Worm gene name: | col-39 |
| Worm sequence name: | C09G5.4 |
| Related human gene: | ectodysplasin A |
| Associated human disease: | ECTODERMAL DYSPLASIA |
| People involved in this project: |
|
| Left primer sequence: | tttccggtgtcttcgttttc |
| Right primer sequence: | gctctttggtccagcaactc |
| Size of PCR product: | 341 |
| Brief description: | There are more than 150 clinically distinct hereditary syndromes in which ectodermal dysplasia is present. Most syndromes are very rare and manifest variable defects in morphogenesis of ectodermal structures, including hair, skin, nails, and teeth (Kere et al., 1996). In the X-linked recessive form, males are usually more severely affected, and females show variable severity, ranging from mild to severe.
There are also autosomal recessive and autosomal dominant forms of the disorder. A distinct form of X-linked hypohidrotic ectodermal dysplasia with immune deficiency has been described. From the Ectodermal Dysplasia web site- What is ED? The ectodermal dysplasia (ED) syndromes are a group of about 150 heritable disorders that affect the ectoderm, the outer layer of tissue in a developing baby. ED syndromes affect both males and females of all races and ethnic groups. The ectoderm contributes to the formation of many parts of the body, including the skin, sweat glands, hair, teeth, and nails. During embryonic development, these and/or other parts of the baby’s body, including the lens of the eye, parts of the inner ear, the fingers and toes, or nerves, among others, may fail to develop normally. When a child has at least two types of abnormal ectodermal features—for example, malformed teeth and extremely sparse hair—the child is identified as being affected by an ED “syndrome.” Each of the roughly 150 ED syndromes represents a different combination of abnormalities. Physical symptoms can range from mild to extremely severe. Very few types of ED involve learning difficulties. |
| Report any problems that might have appeared and any solutions: | |
| Media attachments: |
|
