Home | Projects | Login or register:
Username:   Password:

Worm gene name:  him-6
Worm sequence name:  T0A411.6
Related human gene:  BLM
Associated human disease:  Bloom's syndrome
People involved in this project: 
Left primer sequence:  gattagcgcttctggtcgtc
Right primer sequence:  attttgggagcaaacattcg
Size of PCR product:  872
Brief description:  Phenotype is developmentally delayed (very extended life cycle time), numerous round rather than ovoid embryos but lack of expected number of larvae; planned to examine embryos microscopically for abnormalities, and to use DAPI stain to examine chromosomes for abnormal rearrangements.
Report any problems that might have appeared and any solutions:  No problems
Media attachments: 
  • Studying the Bloom Syndrome gene in Worms  Studying the Bloom Syndrome gene in Worms
     
View(0) or add comments