| Worm gene name: | him-6 |
| Worm sequence name: | T0A411.6 |
| Related human gene: | BLM |
| Associated human disease: | Bloom's syndrome |
| People involved in this project: |
|
| Left primer sequence: | gattagcgcttctggtcgtc |
| Right primer sequence: | attttgggagcaaacattcg |
| Size of PCR product: | 872 |
| Brief description: | Phenotype is developmentally delayed (very extended life cycle time), numerous round rather than ovoid embryos but lack of expected number of larvae; planned to examine embryos microscopically for abnormalities, and to use DAPI stain to examine chromosomes for abnormal rearrangements. |
| Report any problems that might have appeared and any solutions: | No problems |
| Media attachments: |
|
