Home | Projects | Login or register:
Username:   Password:

Worm gene name:  LMNA
Worm sequence name:  f26e4.5
Related human gene: 
Associated human disease:  progeria
People involved in this project: 
Left primer sequence:  tgcacaaggagcagaaactc
Right primer sequence:  caaacctttgcagacttgc
Size of PCR product:  145
Brief description:  distrupt mitosis and induce dna damage in smooth muscle cells.
Report any problems that might have appeared and any solutions: 
View(0) or add comments