| Worm gene name: | LMNA |
| Worm sequence name: | f26e4.5 |
| Related human gene: | |
| Associated human disease: | progeria |
| People involved in this project: |
|
| Left primer sequence: | tgcacaaggagcagaaactc |
| Right primer sequence: | caaacctttgcagacttgc |
| Size of PCR product: | 145 |
| Brief description: | distrupt mitosis and induce dna damage in smooth muscle cells. |
| Report any problems that might have appeared and any solutions: | |
