| Worm gene name: | EPHB2 |
| Worm sequence name: | c54d10.8 |
| Related human gene: | |
| Associated human disease: | prostrate cancer |
| People involved in this project: |
|
| Left primer sequence: | caagaagaaagggctcagga |
| Right primer sequence: | tgacgtcattccaaattttcat |
| Size of PCR product: | 145 |
| Brief description: | mutation gene which causes prostrate/ brain cancer |
| Report any problems that might have appeared and any solutions: | |
