| Worm gene name: | rs3117582 |
| Worm sequence name: | dbSNP |
| Related human gene: | |
| Associated human disease: | Lung Cancer |
| People involved in this project: |
|
| Left primer sequence: | ttcatcggatcgacacaatt |
| Right primer sequence: | ttagtgttcgcatcaacata |
| Size of PCR product: | 80 |
| Brief description: | we are trying to find signs of a change within the worm that might be linkable to lung Cancer |
| Report any problems that might have appeared and any solutions: | |
