Home | Projects | Login or register:
Username:   Password:

Worm gene name:  rs3117582
Worm sequence name:  dbSNP
Related human gene: 
Associated human disease:  Lung Cancer
People involved in this project: 
Left primer sequence:  ttcatcggatcgacacaatt
Right primer sequence:  ttagtgttcgcatcaacata
Size of PCR product:  80
Brief description:  we are trying to find signs of a change within the worm that might be linkable to lung Cancer
Report any problems that might have appeared and any solutions: 
View(0) or add comments