Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Y48G1C.5
Worm sequence name:  Y48G1C.5
Related human gene:  HNMT
Associated human disease:  Asthma
People involved in this project: 
Left primer sequence:  atgagtaggttgatttttat
Right primer sequence:  tattggggtccctcacaaag
Size of PCR product:  0
Brief description:  In Humans: affects the bronchi, increased bronchi-constriction
In Worms: ?
Report any problems that might have appeared and any solutions: 
View(0) or add comments