Worm gene name: | Y48G1C.5 |
Worm sequence name: | Y48G1C.5 |
Related human gene: | HNMT |
Associated human disease: | Asthma |
People involved in this project: |
|
Left primer sequence: | atgagtaggttgatttttat |
Right primer sequence: | tattggggtccctcacaaag |
Size of PCR product: | 0 |
Brief description: | In Humans: affects the bronchi, increased bronchi-constriction
In Worms: ? |
Report any problems that might have appeared and any solutions: | |