| Worm gene name: | R05H5.7 |
| Worm sequence name: | R05H5.7 |
| Related human gene: | MVCD1 |
| Associated human disease: | Diabetes |
| People involved in this project: |
|
| Left primer sequence: | catacaaattgccagcaatc |
| Right primer sequence: | ttattgccacaacaatatcc |
| Size of PCR product: | 0 |
| Brief description: | In Humans: microvascular complications, retinopathy
In Worms: ? |
| Report any problems that might have appeared and any solutions: | |
