| Worm gene name: | Bcs1l |
| Worm sequence name: | C10G11.8 |
| Related human gene: | BCS1L |
| Associated human disease: | Leigh Syndrome |
| People involved in this project: |
|
| Left primer sequence: | tacccgtactcagcacctca |
| Right primer sequence: | tctcgagctttcggtcagtg |
| Size of PCR product: | 230 |
| Brief description: | Leigh syndrome is a severe neurological disorder that typically arises in the first year of life. This condition is characterized by progressive loss of mental and movement abilities (psychomotor regression) and typically results in death within a couple of years, usually due to respiratory failure. A small number of individuals develop symptoms in adulthood or have symptoms that worsen more slowly. |
| Report any problems that might have appeared and any solutions: | |
