| Worm gene name: | pabp-2 |
| Worm sequence name: | c17e4.5 |
| Related human gene: | pabpn1 |
| Associated human disease: | opmd- Oculopharyngeal muscular dystrophy |
| People involved in this project: |
|
| Left primer sequence: | gaaggaatgcaaaacgcact |
| Right primer sequence: | gacctcttggacgaaatcca |
| Size of PCR product: | 193 |
| Brief description: | opmd is characterized by late-onset eyelid drooping, difficulty swallowing. as the disease progresses there is tongue atrophy and weakness.In some cases an incapacitating proximal leg weakness that starts before age 60 years. some need a wheelchair.Life expectancy is not reduced |
| Report any problems that might have appeared and any solutions: | |
