Home | Projects | Login or register:
Username:   Password:

Worm gene name:  pabp-2
Worm sequence name:  c17e4.5
Related human gene:  pabpn1
Associated human disease:  opmd- Oculopharyngeal muscular dystrophy
People involved in this project: 
Left primer sequence:  gaaggaatgcaaaacgcact
Right primer sequence:  gacctcttggacgaaatcca
Size of PCR product:  193
Brief description:  opmd is characterized by late-onset eyelid drooping, difficulty swallowing. as the disease progresses there is tongue atrophy and weakness.In some cases an incapacitating proximal leg weakness that starts before age 60 years. some need a wheelchair.Life expectancy is not reduced
Report any problems that might have appeared and any solutions: 
View(0) or add comments