Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Y53g8ar.8
Worm sequence name:  Y53g8ar.8
Related human gene:  HBB
Associated human disease:  Sickle Cell Anemia
People involved in this project: 
Left primer sequence:  agcatgaaccgggtctattg
Right primer sequence:  tttttgcaaaattttttttc
Size of PCR product:  20
Brief description:  Human:episodes of acute illness and progressive organ damage. Worms: causes problems with excretory cells; Nervous System; head neurons; pharyngeal neurons; unidentified cells in tail
Report any problems that might have appeared and any solutions: 
View(0) or add comments