| Worm gene name: | park-1 |
| Worm sequence name: | f25H8.5 |
| Related human gene: | SNCA |
| Associated human disease: | Parkinson disease |
| People involved in this project: |
|
| Left primer sequence: | tgagtttgaaccacaccccg |
| Right primer sequence: | cctccttggttttggagcct |
| Size of PCR product: | 185 |
| Brief description: | the disease genes and disease pathways in humans are conserved in C. elegans, we can tinker with the genes that regulate neuronal cell death in the nematode. This allows researchers to gain insight on the disease in humans as well |
| Report any problems that might have appeared and any solutions: | |
