Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Kars-1
Worm sequence name:  T02GS.9
Related human gene:  HLA-DRB1
Associated human disease:  Multiple Sclerosis
People involved in this project: 
Left primer sequence:  ccactttcaagcactgtcac
Right primer sequence:  catataatatcatttattga
Size of PCR product:  20
Brief description:  Humans: causes muscle weakness and other health problems such as autoimmune disorders, rheumatoid arthritis, and type 1 diabetes
Worms: Inflammation in the brain, post-vaccinal encephalitis, inflammatory aspects of MS.
Report any problems that might have appeared and any solutions: 
View(0) or add comments