| Worm gene name: | Kars-1 |
| Worm sequence name: | T02GS.9 |
| Related human gene: | HLA-DRB1 |
| Associated human disease: | Multiple Sclerosis |
| People involved in this project: |
|
| Left primer sequence: | ccactttcaagcactgtcac |
| Right primer sequence: | catataatatcatttattga |
| Size of PCR product: | 20 |
| Brief description: | Humans: causes muscle weakness and other health problems such as autoimmune disorders, rheumatoid arthritis, and type 1 diabetes
Worms: Inflammation in the brain, post-vaccinal encephalitis, inflammatory aspects of MS. |
| Report any problems that might have appeared and any solutions: | |
