Home | Projects | Login or register:
Username:   Password:

Worm gene name:  nhr-99
Worm sequence name:  Y53G8AR.8
Related human gene:  HBB
Associated human disease:  Sickle Cell Anemia
People involved in this project: 
Left primer sequence:  agaagtctgccgttactgcc
Right primer sequence:  ttggacagcaagaaagcgag
Size of PCR product:  443
Brief description:  Sickle cell disease describes a group of inherited blood disorders characterized by chronic anemia, painful events, and various complications due to associated tissue and organ damage.
Report any problems that might have appeared and any solutions: 
View(0) or add comments