| Worm gene name: | nhr-99 |
| Worm sequence name: | Y53G8AR.8 |
| Related human gene: | HBB |
| Associated human disease: | Sickle Cell Anemia |
| People involved in this project: |
|
| Left primer sequence: | agaagtctgccgttactgcc |
| Right primer sequence: | ttggacagcaagaaagcgag |
| Size of PCR product: | 443 |
| Brief description: | Sickle cell disease describes a group of inherited blood disorders characterized by chronic anemia, painful events, and various complications due to associated tissue and organ damage. |
| Report any problems that might have appeared and any solutions: | |
