| Worm gene name: | Shn-1 |
| Worm sequence name: | C33B4.3 |
| Related human gene: | SHANK |
| Associated human disease: | Autism |
| People involved in this project: |
|
| Left primer sequence: | gtttttgtggatgtttctag |
| Right primer sequence: | aatggggtttctccctgaaa |
| Size of PCR product: | 0 |
| Brief description: | In Worms: affects calcium and the verebrea.
In Humans: mutations have been found in the autism spectrum diseases. |
| Report any problems that might have appeared and any solutions: | |
