Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Shn-1
Worm sequence name:  C33B4.3
Related human gene:  SHANK
Associated human disease:  Autism
People involved in this project: 
Left primer sequence:  gtttttgtggatgtttctag
Right primer sequence:  aatggggtttctccctgaaa
Size of PCR product:  0
Brief description:  In Worms: affects calcium and the verebrea.
In Humans: mutations have been found in the autism spectrum diseases.
Report any problems that might have appeared and any solutions: 
View(0) or add comments