Home | Projects | Login or register:
Username:   Password:

Worm gene name:  PRNP *not worm name
Worm sequence name:  K07H8.10
Related human gene:  PRNP
Associated human disease:  Huntington Disease
People involved in this project: 
Left primer sequence:  gtacaatcaaaatgggtttc
Right primer sequence:  tatattttcaatgactttat
Size of PCR product:  20
Brief description:  Humans:
Causes neurodegenerative spongiform encephalopathy. Causes uncontrolled movement and emotional problems. Worms: Causes expression in the ASH, ASI, PHA and PHB sensory neurons which is used used to express N-terminal human huntingtin fragments
Report any problems that might have appeared and any solutions: 
View(0) or add comments