Worm gene name: | PRNP *not worm name |
Worm sequence name: | K07H8.10 |
Related human gene: | PRNP |
Associated human disease: | Huntington Disease |
People involved in this project: |
|
Left primer sequence: | gtacaatcaaaatgggtttc |
Right primer sequence: | tatattttcaatgactttat |
Size of PCR product: | 20 |
Brief description: | Humans:
Causes neurodegenerative spongiform encephalopathy. Causes uncontrolled movement and emotional problems. Worms: Causes expression in the ASH, ASI, PHA and PHB sensory neurons which is used used to express N-terminal human huntingtin fragments |
Report any problems that might have appeared and any solutions: | |