Home | Projects | Login or register:
Username:   Password:

Worm gene name:  let-23
Worm sequence name:  ZK1067.1
Related human gene:  ERBB2
Associated human disease:  Gastric Cancer
People involved in this project: 
Left primer sequence:  cccggttgcaatcaaagtat
Right primer sequence:  ttgttgccaaatctctgtgaa
Size of PCR product:  299
Brief description:  Gastric cancer (also known as stomach cancer) is a disease in which the cells that form the inner lining of the stomach become abnormal and begin to divide uncontrollably, forming a mass of cells called a tumor. The human gene, ERBB2, among many other genes is linked to this form of cancer. The gene found in worms that was most related to ERBB2 I found to be let-23.
Report any problems that might have appeared and any solutions: 
View(0) or add comments