| Worm gene name: | let-23 |
| Worm sequence name: | ZK1067.1 |
| Related human gene: | ERBB2 |
| Associated human disease: | Gastric Cancer |
| People involved in this project: |
|
| Left primer sequence: | cccggttgcaatcaaagtat |
| Right primer sequence: | ttgttgccaaatctctgtgaa |
| Size of PCR product: | 299 |
| Brief description: | Gastric cancer (also known as stomach cancer) is a disease in which the cells that form the inner lining of the stomach become abnormal and begin to divide uncontrollably, forming a mass of cells called a tumor. The human gene, ERBB2, among many other genes is linked to this form of cancer. The gene found in worms that was most related to ERBB2 I found to be let-23. |
| Report any problems that might have appeared and any solutions: | |
