| Worm gene name: | gba-3, isoform d |
| Worm sequence name: | F11E6.1 |
| Related human gene: | Glucocerebrosidase |
| Associated human disease: | Parkinson's |
| People involved in this project: |
|
| Left primer sequence: | ggcgatcaatttgtttcctt |
| Right primer sequence: | tttttgaagttttgccgttt |
| Size of PCR product: | 235 |
| Brief description: | GBA-3 is homologous to the human gene, Glucocerebrosidase, a lysosomal enzyme that catalyzes the breakdown of the glycolipid glucosylceramide to ceramide and glucose. GBA is one of many genes that have been associated with susceptibility to the development of late-onset Parkinson's disease. Mutations in this gene lead to Gaucher's disease, which is the most common lysosomal storage disorders; Parkinsonism is an significant feature of Gaucher's disease. |
| Report any problems that might have appeared and any solutions: | |
