| Worm gene name: | K02D10.5 |
| Worm sequence name: | K02D10.5 |
| Related human gene: | SNAP29 |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | agtcgtttttcggtggaatg |
| Right primer sequence: | acaaagacgtggccttcatc |
| Size of PCR product: | 508 |
| Brief description: | The experiment is incomplete, but at this time, PCR has been done. |
| Report any problems that might have appeared and any solutions: | |
