Home | Projects | Login or register:
Username:   Password:

Worm gene name:  K02D10.5
Worm sequence name:  K02D10.5
Related human gene:  SNAP29
Associated human disease: 
People involved in this project: 
Left primer sequence:  agtcgtttttcggtggaatg
Right primer sequence:  acaaagacgtggccttcatc
Size of PCR product:  508
Brief description:  The experiment is incomplete, but at this time, PCR has been done.
Report any problems that might have appeared and any solutions: 
View(0) or add comments