Home | Projects | Login or register:
Username:   Password:

Worm gene name:  dys-1
Worm sequence name:  F15D3.1
Related human gene:  Dystrophin (DMD)
Associated human disease:  Duchenne Muscular Dystrophy
People involved in this project: 
Left primer sequence:  gagtgggtattcgtgcgct
Right primer sequence:  ccaatcgtcggatggattac
Size of PCR product:  153
Brief description:  Duchenne muscular dystrophy results in the progressive weakening of skeletal muscles, defective muscle proteins, and the degeneration of muscular tissue. It's caused by a lack of the protein dystrophin, as result of mutations in the gene dystrophin (DMD). Deletions in the gene result in a frameshift, which changes the reading frame, and the end product of translation. Dystrophin the protein is a part of a protein complex that works to strengthen muscle fibers and prevent injury. This large, rod-like protein behaves as an anchor by connecting the the structural framework of each muscle cell to the extracellular matrix. The gene dys-1 is an ortholog of the human gene DMD. When the gene is silenced, muscular dystrophy is induced. C. Elegans is a useful model for studying treatments, as aspects of cell behavior such as as intracellular signaling, cell to cell communication, and the interactions between the cell-surface and extracellular matrix proteins can be compared between healthy worms and those with the mutated gene.
Report any problems that might have appeared and any solutions:  none
View(0) or add comments