| Worm gene name: | dys-1 |
| Worm sequence name: | F15D3.1 |
| Related human gene: | Dystrophin (DMD) |
| Associated human disease: | Duchenne Muscular Dystrophy |
| People involved in this project: |
|
| Left primer sequence: | gagtgggtattcgtgcgct |
| Right primer sequence: | ccaatcgtcggatggattac |
| Size of PCR product: | 153 |
| Brief description: | Duchenne muscular dystrophy results in the progressive weakening of skeletal muscles, defective muscle proteins, and the degeneration of muscular tissue. It's caused by a lack of the protein dystrophin, as result of mutations in the gene dystrophin (DMD). Deletions in the gene result in a frameshift, which changes the reading frame, and the end product of translation. Dystrophin the protein is a part of a protein complex that works to strengthen muscle fibers and prevent injury. This large, rod-like protein behaves as an anchor by connecting the the structural framework of each muscle cell to the extracellular matrix. The gene dys-1 is an ortholog of the human gene DMD. When the gene is silenced, muscular dystrophy is induced. C. Elegans is a useful model for studying treatments, as aspects of cell behavior such as as intracellular signaling, cell to cell communication, and the interactions between the cell-surface and extracellular matrix proteins can be compared between healthy worms and those with the mutated gene. |
| Report any problems that might have appeared and any solutions: | none |
