Home | Projects | Login or register:
Username:   Password:

Worm gene name:  cdk-1
Worm sequence name:  T05G5.3
Related human gene:  cdk-1
Associated human disease:  cancer
People involved in this project: 
Left primer sequence:  gctgtgcgagagatcagctt
Right primer sequence:  taagagtttcgagcggaagg
Size of PCR product:  175
Brief description:  The gene codes for a protein that is vital during cell division. The presence of the protein complex is necessary for mitosis. if there is an error, then mitosis does not continue.
Report any problems that might have appeared and any solutions:  none
View(0) or add comments