| Worm gene name: | eff-1 |
| Worm sequence name: | C26D10.5 |
| Related human gene: | none |
| Associated human disease: | none |
| People involved in this project: |
|
| Left primer sequence: | cacacagtgctgattcgacg |
| Right primer sequence: | gaagcaccgttggaaacatt |
| Size of PCR product: | 222 |
| Brief description: | eff-1 is a cell fusion coding gene that when dysfunctional, creates an ectopic phenotype in the worms in which the embryos hatch inside the adults; produces the "bag of worms" phenotype. |
| Report any problems that might have appeared and any solutions: | The bag of worms phenotype was not seen. Instead a blistered phenotype was seen on worms. Blister was more prevalent in L4 and adult worms. |
| Media attachments: |
|
