Home | Projects | Login or register:
Username:   Password:

Worm gene name:  eff-1
Worm sequence name:  C26D10.5
Related human gene:  none
Associated human disease:  none
People involved in this project: 
Left primer sequence:  cacacagtgctgattcgacg
Right primer sequence:  gaagcaccgttggaaacatt
Size of PCR product:  222
Brief description:  eff-1 is a cell fusion coding gene that when dysfunctional, creates an ectopic phenotype in the worms in which the embryos hatch inside the adults; produces the "bag of worms" phenotype.
Report any problems that might have appeared and any solutions:  The bag of worms phenotype was not seen. Instead a blistered phenotype was seen on worms. Blister was more prevalent in L4 and adult worms.
Media attachments: 
  • blistered worms  blistered worms
     
View(0) or add comments