| Worm gene name: | cua-1 |
| Worm sequence name: | Y76A2A.2a |
| Related human gene: | ATP7A |
| Associated human disease: | Hailey-Hailey |
| People involved in this project: |
|
| Left primer sequence: | acgtgaaatgggtcttcgtg |
| Right primer sequence: | ttgacaccgtctccaaccat |
| Size of PCR product: | 183 |
| Brief description: | locomotion variant phenotype observed; also body length seemed to be longer than wild-type body length |
| Report any problems that might have appeared and any solutions: | |
