Home | Projects | Login or register:
Username:   Password:

Worm gene name:  cua-1
Worm sequence name:  Y76A2A.2a
Related human gene:  ATP7A
Associated human disease:  Hailey-Hailey
People involved in this project: 
Left primer sequence:  acgtgaaatgggtcttcgtg
Right primer sequence:  ttgacaccgtctccaaccat
Size of PCR product:  183
Brief description:  locomotion variant phenotype observed; also body length seemed to be longer than wild-type body length
Report any problems that might have appeared and any solutions: 
View(0) or add comments