| Worm gene name: | fbn-1 |
| Worm sequence name: | ZK783.1 |
| Related human gene: | FBN1 |
| Associated human disease: | Marfan Syndrome |
| People involved in this project: |
|
| Left primer sequence: | gagccaatgccaaatgtgtt |
| Right primer sequence: | cacatgaatccatctccacg |
| Size of PCR product: | 355 |
| Brief description: | Compared to Wild-type C. elegans worms, the fbn-1 RNAi treated worms were much skinnier and longer. In addition, their head twitched as well. |
| Report any problems that might have appeared and any solutions: | |
