Home | Projects | Login or register:
Username:   Password:

Worm gene name:  fbn-1
Worm sequence name:  ZK783.1
Related human gene:  FBN1
Associated human disease:  Marfan Syndrome
People involved in this project: 
Left primer sequence:  gagccaatgccaaatgtgtt
Right primer sequence:  cacatgaatccatctccacg
Size of PCR product:  355
Brief description:  Compared to Wild-type C. elegans worms, the fbn-1 RNAi treated worms were much skinnier and longer. In addition, their head twitched as well.
Report any problems that might have appeared and any solutions: 
View(0) or add comments