| Worm gene name: | nhr-49 |
| Worm sequence name: | wild type C. elegans |
| Related human gene: | hnf4a |
| Associated human disease: | monogenic, autosomal dominant, non-insulin-dependent, diabetes mellitus type I |
| People involved in this project: |
|
| Left primer sequence: | ccaactggaatgctctcagc |
| Right primer sequence: | ggggtaatgattcaaaacaacaa |
| Size of PCR product: | 213 |
| Brief description: | Student project. A set of experiments were done to knock down the expression of the gene, nhr-49. The expected phenotypic result was obesity and shortened life-span. |
| Report any problems that might have appeared and any solutions: | The expected phenotype was not present. When confirmational PCR was run on the feeding strain bacteria, the expected band was not present. The RNAi was not successfully executed in this experiment. |
