| Worm gene name: | Mod-1 |
| Worm sequence name: | K06C4.6 |
| Related human gene: | |
| Associated human disease: | |
| People involved in this project: |
|
| Left primer sequence: | cttgcaatttggatctgcg |
| Right primer sequence: | ccagtacccgtttggatagag |
| Size of PCR product: | 206 |
| Brief description: | Feed DP123 worms a constructed feeding strain containing the PCR product of our primers. Also feed DP123 worms OP50 bacteria. Examined both worms using fluorescence microscopy and the Mod-1 knockdown worms were drastically larger and were fluorescent all over as opposed to proximal ends. N2 worms were also used as controls, but there was not as drastic of a phenotypic change. |
| Report any problems that might have appeared and any solutions: | |
