Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Mod-1
Worm sequence name:  K06C4.6
Related human gene: 
Associated human disease: 
People involved in this project: 
Left primer sequence:  cttgcaatttggatctgcg
Right primer sequence:  ccagtacccgtttggatagag
Size of PCR product:  206
Brief description:  Feed DP123 worms a constructed feeding strain containing the PCR product of our primers. Also feed DP123 worms OP50 bacteria. Examined both worms using fluorescence microscopy and the Mod-1 knockdown worms were drastically larger and were fluorescent all over as opposed to proximal ends. N2 worms were also used as controls, but there was not as drastic of a phenotypic change.
Report any problems that might have appeared and any solutions: 
View(0) or add comments