| Worm gene name: | ncr-1 |
| Worm sequence name: | F02E8.6 |
| Related human gene: | NPC1 |
| Associated human disease: | Niemann-Pick type C disease |
| People involved in this project: |
|
| Left primer sequence: | ggtgcctggattcacaactt |
| Right primer sequence: | gatggtccaccgtatgttcc |
| Size of PCR product: | 977 |
| Brief description: | Expression of ncr-1 gene is widespread and involves the distribution pattern of cholesterol in various tissues of C. elegans. It was chosen because of it has a human gene homologue- NPC1- that results in Niemann Pick type C disease.
<-br> In C. elegans, we expected embryos to die during embryonic development or have a phenotype related to lipid concentrations; when RRF-3 worms were fed e.coli HT115 transformed with plasmid L4440 which was ligated with F02E8.6 PCR insert. |
| Report any problems that might have appeared and any solutions: | After putting RRF3 worms on our RNAi feeding plates, we left them over the weekend. When we observed the worms on Monday, an obvious phenotype was not apparent. We considered that perhaps the worms needed longer exposure to the RNAi feeding plate, so we seeded more plates so the worms could have fresh bacteria. At this point in time, we cannot form a conclusion about the phenotype. Our future experiments will include using a stain to reveal lipid concentrations as well as removing all worms from the plates so we can track embryonic development. |
| Media attachments: |
|
