| Worm gene name: | gap-2 |
| Worm sequence name: | ZK899.8a |
| Related human gene: | gap-2 |
| Associated human disease: | neurofibro |
| People involved in this project: |
|
| Left primer sequence: | gtacaggtcgccatcaaggt |
| Right primer sequence: | agcgtcttggcaatcagagt |
| Size of PCR product: | 962 |
| Brief description: | gap-2 codes for a RAS GTPase Activating Protein and is homologous to the human gene NF1, the mutation of which causes neurofibromatosis. in this disease, tumors grow in the nervous system for reasons that are not yet completely understood. In our experiment, the gap-2 gene was knocked down via the RNAi mechanism and the phenotypes observed. the primers listed above were successful in amplifying the gap-2 gene and gel electrophoresis showed that the PCR product was the expected size. |
| Report any problems that might have appeared and any solutions: | |
