| Worm gene name: | ifa-1 |
| Worm sequence name: | F38B2.1c.1 |
| Related human gene: | Keratin 2 |
| Associated human disease: | Ichthyosis |
| People involved in this project: |
|
| Left primer sequence: | tgctcaaaattgtgaccgag |
| Right primer sequence: | ccgaggagagttcgttcttg |
| Size of PCR product: | 900 |
| Brief description: | Ichthyosis bullosa of Siemens (IBS) is an autosomal dominant disorder that affects the skin. Ichthyosis is characterized by the dry and scaly skin that forms. Individuals with the disease are born with widespread blistering which eventually spread to the extremities. Disease is associated with a missense mutation on the keratin 2e gene. The ifa-1 is a homolog for the keratin 2 gene, and it is an intermediate filament gene that is essential for survival past the L1 larva stage. It is also required for normal intestinal development |
| Report any problems that might have appeared and any solutions: | Primers for the ifa-1 gene worked well; Product size on the feeding strain was larger than the expected size of 900bp, ended up with a PCR product between 2500bp -3000bp. The phenotype of the ifa-1 gene did not have any change compared to the wild-type worm after 48 hours of incubation, longer incubation time may be a solution. Another possible solution would be to compare the ifa-1 knockdown with an ifa-1 knockout worm. |
