Home | Projects | Login or register:
Username:   Password:

Worm gene name:  tub-1
Worm sequence name:  F10B5.4
Related human gene:  FUR1
Associated human disease:  Obesity
People involved in this project: 
Left primer sequence:  aaaactacaaatcacgcggc
Right primer sequence:  gggagcaaccgagattgtta
Size of PCR product:  662
Brief description:  This gene involves regulation of fat storage in the head and in the tail region.
Report any problems that might have appeared and any solutions:  The expected results using this gene were that the worms should exhibit a "tubby" or larger than normal body size. The experiment was successful, in that when a feeding strain was constructed and used, the phenotype observed was that the worms were significantly larger all around when compared to the wild type worms.
View(0) or add comments