Home | Projects | Login or register:
Username:   Password:

Worm gene name:  gap-2
Worm sequence name:  ZK889.8a
Related human gene:  gap-2
Associated human disease:  Neurofibromatosis
People involved in this project: 
Left primer sequence:  gtacaggtcgccatcaaggt
Right primer sequence:  agcgtcttggcaatcagagt
Size of PCR product:  962
Brief description:  GTPase Activating Protein family. encodes a Ras GTPase-activating protein essential for postnatal survival and neuronal development.
Report any problems that might have appeared and any solutions: 
View(0) or add comments