| Worm gene name: | gap-2 |
| Worm sequence name: | ZK889.8a |
| Related human gene: | gap-2 |
| Associated human disease: | Neurofibromatosis |
| People involved in this project: |
|
| Left primer sequence: | gtacaggtcgccatcaaggt |
| Right primer sequence: | agcgtcttggcaatcagagt |
| Size of PCR product: | 962 |
| Brief description: | GTPase Activating Protein family. encodes a Ras GTPase-activating protein essential for postnatal survival and neuronal development. |
| Report any problems that might have appeared and any solutions: | |
