| Worm gene name: | sca-1 |
| Worm sequence name: | K11D9.2a.1 |
| Related human gene: | ATP2A2 |
| Associated human disease: | Darier Disease |
| People involved in this project: |
|
| Left primer sequence: | tgaaatggttcttgctgacg |
| Right primer sequence: | atccattcgacccagttgag |
| Size of PCR product: | 816 |
| Brief description: | The purpose of this project was to induce the gene for a human disease, Darier Disease, in C. elegans by RNAi-induced feeding strain and observe any changes in the phenotype. |
| Report any problems that might have appeared and any solutions: | The primers were successful in letting us see the amplicon length, and all of the transformations were successful. However, the gel electrophoresis after the transformations showed that the length of the PCR product was greater than 1.2 kilo base pairs, larger than our expected target. We attributed this increase and the T7 forward promotor, needed to transcribe the insert, including the gene of interest, annealed and transcribed all the way around the plasmid before the T7 reverse annealed, resulting in the larger length. The RNAi feeding strain was successful in inducing a change in the phenotypes of the worms: they were noticed to have dark spots, or bubbles, on their exterior and were digging in the agar, which is not usually typical of wild-type worms. Therefore, I believe that there was a successful knockdown of the sca-1 gene. |
