Home | Projects | Login or register:
Username:   Password:

Worm gene name:  hypothetical protein (NP_493545)
Worm sequence name:  Y105E8B.5 (ortholog of human HPRT1)
Related human gene:  hypoxanthine phosphoribosyltransferase 1
Associated human disease:  Lesch-Nyhan
People involved in this project: 
Left primer sequence:  ctcagacatccacgctgaaa
Right primer sequence:  aacatccacgacacgtttga
Size of PCR product:  367
Brief description:  In humans, the protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout. Lesh-Nyhan is an X-linked disorder, affecting mostly males (about 1 in 380,000 people). Inability to recycle purines results in bizarre movements, deep tendon reflexes, and self-mutilation behavior. It may also result in gout-like swelling of joints and/or kidney stones due to a buildup of uric acid. In worms, Y105E8B.5 gave pehnotypes such as reduced or varied fat content, variations in cell secretion, different transgene expression patterns and expression levels.
Report any problems that might have appeared and any solutions: 
View(0) or add comments