| Worm gene name: | hypothetical protein (NP_493545) |
| Worm sequence name: | Y105E8B.5 (ortholog of human HPRT1) |
| Related human gene: | hypoxanthine phosphoribosyltransferase 1 |
| Associated human disease: | Lesch-Nyhan |
| People involved in this project: |
|
| Left primer sequence: | ctcagacatccacgctgaaa |
| Right primer sequence: | aacatccacgacacgtttga |
| Size of PCR product: | 367 |
| Brief description: | In humans, the protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout. Lesh-Nyhan is an X-linked disorder, affecting mostly males (about 1 in 380,000 people). Inability to recycle purines results in bizarre movements, deep tendon reflexes, and self-mutilation behavior. It may also result in gout-like swelling of joints and/or kidney stones due to a buildup of uric acid. In worms, Y105E8B.5 gave pehnotypes such as reduced or varied fat content, variations in cell secretion, different transgene expression patterns and expression levels. |
| Report any problems that might have appeared and any solutions: | |
