| Worm gene name: | egl-19 |
| Worm sequence name: | C48A7.1 |
| Related human gene: | voltage-gated sodium channel type V alpha isoform e |
| Associated human disease: | Ward-Romano syndrome |
| People involved in this project: |
|
| Left primer sequence: | gcaagtacggtcaaaccgat |
| Right primer sequence: | catgtttcaaacccttggct |
| Size of PCR product: | 586 |
| Brief description: | The Romano-Ward or Ward-Romano syndrome is a form of heart arrhythmia that shows a long QT syndrome in an EKG. About 1 in 7,000 people have this syndrome and it is inherited in an autosomal dominant pattern. There are several gene mutations that are known to cause this syndrome, most of which code for a sodium or potassium channel. |
| Report any problems that might have appeared and any solutions: | The best sequence alignment between the human gene I chose to look at (voltage-gated sodium channel type V alpha isoform e) ended up being a calcium channel gene in the worm. I think this may still be interesting, as these experiments may answer some questions about evolutionary form and function in ion channels. |
