| Worm gene name: | sax-3 |
| Worm sequence name: | ZK377.2 |
| Related human gene: | DSCAM |
| Associated human disease: | Down Syndrom Congenital Heart Disease |
| People involved in this project: |
|
| Left primer sequence: | gtagcggctagaagcaatgg |
| Right primer sequence: | cgccagtcagttgagcataa |
| Size of PCR product: | 552 |
| Brief description: | Down syndrome (DS) is a major cause of congenital heart disease (CHD) and the most frequent known cause of atrioventricular septal defects (AVSDs). Molecular studies of rare individuals with CHD and partial duplications of chromosome 21 established a candidate region that included D21S55 through the telomere. We now report human molecular and cardiac data that narrow the DS-CHD region, excluding two candidate regions, and propose DSCAM (Down syndrome cell adhesion molecule) as a candidate gene. |
| Report any problems that might have appeared and any solutions: | Primer Sequence:
gtagcggctagaagcaatggtggagttggagtctcacatggaacgagtgaagtcatcatg agtatgttaattgaataattgcagaaaagatgactaaattttaattatgttaattttaag atcaagacacgctggaaaaacaccttgctgctcaacaagaaaacgaatcatttttgtatg ggctgatcaataaatctcatgttcctgtgattgtcattgttgcaattctgattattttcg tagtcatcattatagcctattgttactggaggaatagcagaaacagtgatggaaaggatc gaagttttataaagatcaatgatggaagtgttcatatggcttcgaataatctttgggatg ttgcacaaaatccgaatcagaatccaatgtacaacactgctggaagaatgactatgaaca atagaaatggccaggctctctattcgctgacaccaaatgcgcaagactttttcaacaatt gtgatgactacagtggaacgatgcacagaccaggatccgagcatcactatcattatgctc aactgactggcg |
