| Worm gene name: | ceh-45 |
| Worm sequence name: | ZK993.1 |
| Related human gene: | Goosecoid |
| Associated human disease: | Involved in early embryogenesis |
| People involved in this project: |
|
| Left primer sequence: | accatcaacactacgcctcc |
| Right primer sequence: | aactacacggccaaggattg |
| Size of PCR product: | 300 |
| Brief description: | Interested in embryo implantation and read reports on this gene that is hoghly conserved in human, mouse and frogs. |
| Report any problems that might have appeared and any solutions: | Low efficiency, but this can hopefully be improved. |
