| Worm gene name: | let-381 |
| Worm sequence name: | F26B1.7 |
| Related human gene: | FoxF1 |
| Associated human disease: | Alveolar Capillary Dysplasia |
| People involved in this project: |
|
| Left primer sequence: | taaccctttgtaagcgtggc |
| Right primer sequence: | gcattgggaattcagcagtt |
| Size of PCR product: | 493 |
| Brief description: | This gene was the first pick for an ortholog search for human FoxF1 which has been recently implicated to cause Alveolar Capillary Dysplasia. |
| Report any problems that might have appeared and any solutions: | |
