Home | Projects | Login or register:
Username:   Password:

Worm gene name:  let-381
Worm sequence name:  F26B1.7
Related human gene:  FoxF1
Associated human disease:  Alveolar Capillary Dysplasia
People involved in this project: 
Left primer sequence:  taaccctttgtaagcgtggc
Right primer sequence:  gcattgggaattcagcagtt
Size of PCR product:  493
Brief description:  This gene was the first pick for an ortholog search for human FoxF1 which has been recently implicated to cause Alveolar Capillary Dysplasia.
Report any problems that might have appeared and any solutions: 
View(0) or add comments