Worm gene name: | apr-1 |
Worm sequence name: | k04G2.8a |
Related human gene: | APC Beta-catenin binding protein |
Associated human disease: | familial adenomatous polyposis |
People involved in this project: |
|
Left primer sequence: | tcttcctgcgtcaaactgtg |
Right primer sequence: | cagcaagattccacaaagca |
Size of PCR product: | 900 |
Brief description: | embrogenesis |
Report any problems that might have appeared and any solutions: | |