Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Xpa-1
Worm sequence name:  K07G5.2
Related human gene:  Xeroderma pigmentosum complementation group A
Associated human disease:  Xeroderma pigmentosum
People involved in this project: 
Left primer sequence:  aattttcaggcgaagaagca
Right primer sequence:  ttcggaacgaacttctttgg
Size of PCR product:  474
Brief description:  The sequence has 4 introns and 5 exons and an end uncoding region.
Report any problems that might have appeared and any solutions:  none.
View(0) or add comments