| Worm gene name: | Xpa-1 |
| Worm sequence name: | K07G5.2 |
| Related human gene: | Xeroderma pigmentosum complementation group A |
| Associated human disease: | Xeroderma pigmentosum |
| People involved in this project: |
|
| Left primer sequence: | aattttcaggcgaagaagca |
| Right primer sequence: | ttcggaacgaacttctttgg |
| Size of PCR product: | 474 |
| Brief description: | The sequence has 4 introns and 5 exons and an end uncoding region. |
| Report any problems that might have appeared and any solutions: | none. |
